Submission information file (covering entire project)
TYPE: 	Cont
STATUS: 	New
NAME: 	Schuyler S. Korban
LAB:            	Apple EST Project
INSTITUTION:    	U. Illinois
ADDRESS:        	310 ERML, U. Illinois, 1201 W. Gregory, Urbana, IL 61801
TEL:            	(217) 333-8298
FAX:            	217-333-8298
EMAIL:          	korban@uiuc.edu
-------------------------
Publication information file (covering entire project)
TYPE: 	Pub
STATUS: 	New
MEDUID:	
TITLE:	<project name...use same name as in the sub. info. file above>
AUTHORS:	<Korban, S., Vodkin L., Liu, L., Gasic, K., Gonzales, O., Hernandez, A., Aldwinckle, H., Malnoy, M., Clifton, S., Carroll, N., Goldsbrough P., Orvis, K., ...WashU staff is added here>
JOURNAL:        	<publishing journal name...usually blank...unpublished>
VOLUME:         	<journal info. usually blank...unpublished>
PAGES:          	<journal info. usually blank...unpublished>
YEAR:           	<journal info. usually blank...unpublished>
STATUS:         	<publication status...usually "1" implying unpublished>

Plate shipment information template (per library in shipment)
-------------------------------------------------------------
Library name: 	Mdst
New library: 	Yes
Plate names: 	Mdst6001 - Mdst6026; 
Plate format: 	384-well
Date plates shipped: 	(7/26/04)
Library materials provided by: 	Schuyler S.  Korban
Library constructed by: 	K. Gasic
Library re-arrayed by: 	N/A
Organism: 	Malus × domestica (apple) cv. GoldRush
Tissue: 	Shoot
Developmental stage: 	dormant shoot internodes, active shoot internodes, actively-growing shoot internodes
Sex: 	(gender if applicable)
Host cell: 	DH10B ampicillin resistant
Vector: 	pBluescript II SK (+)
Vector_type: 	Phagemid (ampicillin resistant)
RE_3': 	Not I
RE_5':	EcoRI

DESCR:
Total RNA was extracted separately from each stage
[dormant shoot internodes, active shoot internodes, actively-growing shoot internodes],
 using the "pine tree" method. Poly(A)+mRNA was isolated twice
from total RNA from each stage using the Oligotex
Direct mRNA kit (Qiagen). mRNA was reverse transcribed
into double stranded cDNA using a modified oligo18(dT)
primer with an identifying tag sequence (see table below).
cDNA's from different stages were pooled in equal amounts
before adaptor ligation.

Tag identification when sequencing from 5' end:
Stage 1 (dormant shoot internodes) insert 18(A)TCGTG;
Stage 2 (active shoot internodes) insert 18(A)TGCTG;
Stage 3 (actively-growing shoot internodes) insert 18(A)TCGGT;

Tag identification when sequencing from 3' end:
Stage 1 (dormant shoot internodes) CACGA18(T) insert;
Stage 2 (active shoot internodes) CAGCA18(T) insert;
Stage 3 (actively-growing shoot internodes) ACCGA18(T) insert;


Double stranded cDNAs were size selected
(more than 450 bp), adaptored with EcoRI
adapters at both ends and then digested with NotI.
The cDNAs were then directionally cloned into
EcoR1-NotI digested pBS II SK(+) phagemid vector(Stratagene).

Identification of adaptors and tags in 5'-end sequenced clones:
<Vector>...TAAGCTT<End Vector><Start EcoR1_adaptor>GATATCGAATTCCATTGTGTTGGG
<End EcoR1_adaptor><Start Insert>....AAAAAAAAAAAAAAAAAA<End Insert>
<Start Tag>TGCGA<End Tag><Start NotI_site/Vector>GCGGCCGCCACCGCGG...

The total number of white colony forming units (cfu)
in the primary library before amplification was 2.7x10^7
cfu (colony forming units). The background of empty clones
was less than 2%. Inserts ranged from 0.5kb to 4 kb,
as determined by PCR.

Purified plasmid DNA from the primary library was
converted to single-stranded circles and used as a
template for PCR amplification using the T7 and T3 priming
sites flanking the cloned cDNA inserts. The purified
PCR products, representing the entire cloned cDNA population,
were used as a driver for normalization.
Hybridization between the single-stranded library and the
PCR products was carried out for 44 hours at 30C.
Unhybridized single-stranded DNA circles were separated
from hybridized DNA rendered partially double-stranded
and electroporated into DH10B cells to generate the
normalized library.

The total number of clones with insert was 8x10^5 cfu.
Background of empty clones was less than 1%.